Research Paper - (2020) Volume 11, Issue 4
1Department of Science Laboratory Technology, The Oke-Ogun Polytechnic, Oke-Ogun, Saki Oyo State, Nigeria
2Department of Pure and Applied Biology, Ladoke Akintola University of Technology, Ogbomoso, Nigeria
3Department of Microbiology and Botany, University of Ibadan, Ibadan, Nigeria
4Department of Zoology, Parasitology Unit, University of Ibadan, Ibadan, Nigeria
5Department of Zoology, Cellular Parasitology Unit, University of Ibadan, Ibadan, Nigeria
6Leeds City University, Ibadan, Nigeria
Received date: July 09, 2020; Accepted date: July 23, 2020; Published date: August 01, 2020
Citation: Adeoti OM, Olaleye OM, Adeoye KA, Adesina DA, Olaoye OJ, et al. (2020) Molecular Typing of 16S rRNA of Azadiracht indica and Ocimum gratissimum Resistant Pseudomonas spp. from Sabe in Oke-Ogun, Nigeria. Arch Clin Microbiol Vol. 11 No. 4:117. DOI: 10.36648/1989-8436.11.4.117
Copyright: © 2020 Adeoti OM, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
The aim of this study was to present the molecular typing of bacteria which were resistant to extract of the leaves of Ocimum gratissimum and Azadirachta indica and to investigate whether there was any relationship between non-sensitivity to antibiotics and the extract of plants of four isolates: Salmonella typhii, Escherichia coli, Pseudomonas aeruginosa and Pseudomonas monteilii. Four solvents used for the extraction of the active ingredients of the plants were Ethanol, N-Hexane, Water, Ethanol and Water combined in five different concentrations.
The four microorganisms listed above were isolated from raw milk, Borehole water and soil. The isolates were variously subjected to conventional morphological, biochemical tests and subsequently molecular screening (Polymerase Chain Reaction (PCR) and Sanger sequencing method). Pseudomonas aeruginosa (KF530797) and Pseudomonas monteilii (KJ676707) identified were subjected to BLAST using pairwise alignment technique from NCBI database. The two plant extracts had earlier been documented as resistant to Escherichia coli and Salmonella spp. which were earlier isolated from milk and water, respectively.
There was no zone of inhibition as observed in all concentrations of plant extract considered except a noticeable clear zone of inhibition against synthetic antibiotics in the order of Ofloxacin and Gentamycin. Although suspected gene markers from the two-soil isolate were suspected to be amplified around 1400 bp. The 16S rRNA sequences of Pseudomonas aeruginosa (94.43%) was somewhat more variable than Pseudomonas monteilii (99.93%) indicating a pairwise alignment of Pseudomonas monteilii to be more conserved than P. aeruginosa.
Keywords
Pseudomonas monteilii; BLAST; Antimicrobial; Pairwise-alignment; Gene Markers
Abbreviations
BLAST: Basic Local Alignment Sequence Tools
Introduction
The ingenuity of chemists has produced many new potent antimicrobial agents, but resistant bacterial strains have consistently emerged. Many authors have reported that plants contain a largeform of bioactive constituents [1,2]. Neemmay be a well-known plant that originated from Bharat and its neighbouring countries as way back as thousands of years ago [3]. It is thought to be one amongst the foremost helpful medicinal plants with a large spectrum of biological activity. Neem tree derived its name from ‘Arishtha’ that is translated as ‘ reliever of sickness ’ and therefore it is considered as ‘ Sarbaroganibarini ’ in Bharat. The primary bitter compound isolated from Melia Azadirachta oil, with overa hundred thirty- five compounds are isolated from completely differentcomponents of neem; these aremultifariouslyinvolved as antimicrobials against some organisms: Eubacteriummutans and S. faecalis. Oil from Melia Azadirachta leaves, seeds and bark possesses a large spectrum of bactericide action against microorganisms, as well asMycobacteriumand antibiotic resistant strains. This plant manufacturea largeform of secondary metabolites thatare used either directly as precursors or as lead compounds within the pharmaceutical business and it is expected that plant extracts showing target sites are active against drug resistant microbial pathogens [4,5]. Ocimum gratissimum is a scented ligneous plant with lime-inexperienced leaves [6]. Ocimum gratissimum is employed through geographical region as anti-protozoal infection. The crushed leaf juice is employedwithin the treatment of convulsion, abdomen pain and redness. Oil from the leaves are found to possess antiseptics, bactericide, and antifungal activities [2]. The plant is highly consumed by the Igbos as a foliaceous vegetables and therefore theorganic process importance of this plant centre on its utility as a seasoning because of its aromatic flavour. It isconjointlyemployed by the Igbos within the treatment of the baby ’ s wire. Pseudomonas is Gram-negative ubiquitous microorganism with extreme metabolic versatility [7]. P.aeruginosa is known to have colonized several environmental niches and is able to persist and grow under intense poor- nutrient and inhospitable habitat [8].
Although the 16S rRNA gene is the basic tool of the current bacterial classification system, it is known that closely related species of bacteria cannot be differentiated based on this gene. Therefore, over the past 10 years, other gene sequences have been used as phylogenetic molecular markers in taxonomic studies [9-11], such as atpD, gyrB, rpoB, recA, and rpoD Mulet and collaborators have demonstrated that the analysis of the sequences of four housekeeping genes (16S rRNA, gyrB, rpoB, and rpoD) in all known species of the genus clarified the phylogeny and greatly facilitated the identification [12,13]. The multilocus sequence analysis (MLSA) approach based on the sequence analysis of the four housekeeping genes has proven reliable for species delineation and strain identification in Pseudomonas [14].
Justification
The use 16S rRNA gene sequences as housekeeping molecular markers cannot be over emphasized varying from evolutionary and taxonomic importance. Bacterial 16S rRNA genes contain nine hypervariable regions (V1-V9) that indicates considerable sequence diversity among different microorganisms. The present study presented another opportunity to explore 16S rRNA analysis of antimicrobial resistance to local herbs vis-a-viz their phylogenetic relatedness of two strains of Pseudomonas isolated in the rhizosphere of the two herbal plants.
Materials and Methods
Collection of plants samples
The plant leaves of both Ocimum gratissimum(scent leaf) and Azadirachta indica were collected from a farm settlement at Sabe community in ATISBO Local Government Area of Oyo State in Southwest region of Nigeria.The two plantswere sent for identification in the Department of Biological sciences, University of Ibadan, Oyo State. The residual moisture was evaporated at room temperature thereafter the fresh leaves samples could air dry completely for two weeks at a room temperature before used them for this study (Figure 1).
Figure 1: Gel electrophoresis purification of Polymerase Chain Reaction amplicon ’ s on representatives ’ bacteria isolate from soil (S5P and N5P) using Pseudomonas aeruginosa and Pseudomonas monteilii.
Sample preparations and extraction
The air-dried plant sample was grinded using pestle and mortar into a powdered form and was thoroughly sieved through 2 mm sized mesh sieve and was later stored in plastic containers.
Biochemical analysis
Gram staining procedures: Using wire loop to inoculate the bacterial colony by preparing a smear which was prepared and fixed on clean glass slide the stained with crystal violet for 30 seconds before the smear was washed with distilled water. Gram’s Iodine was added thereafter for 10 seconds then the smear was washed with tap water and decolorized with 95% Acetone alcohol and Safranin which is a secondary dye was finally added to the smear for 30 seconds in tap water. This was air dried and mounted to be observed under oil immersion objective 100X.
Oxidase test
The reagent was prepared according to manufacturer ’ s instruction. A 2-3 drops of freshly prepared oxidase reagent was placed on to the filter paper contained in a Petri dish. Using a wooden stick some of the growth of test organism grown on non-selective agar (i.e. nutrient agar) was smear- flooded onto the treated filter paper. Those bacteria which gave the positive result by changing the filter paper into deep blue purple colour within 10 second were reported as oxidase positive modification of the [15,16].
Identification of isolates
Isolates from primary cultures was incubated at ± 37?C-44?C) were aseptically subcultured on to fresh Agar media (EMB, MacConkey agar, Simon’s Citrate, Centrimid, SSA and Nutrient agar) in at least five successive generations. The resultant pure isolates were subcultured into already prepared slant bottles for the purpose of identification and characterization. At this level, cultural characteristics, and appropriate biochemical identification such as oxidase, catalase, urease, indole, and citrate were used to determine the production and utilization of some various enzymes (Table 1).
| Conc. (µM) | Ethanol | N-Hexane | Ethanol + aqueous | Aqueous |
|---|---|---|---|---|
| 25 | 9.67±10.00 | 10.00±11.00 | 8.33±11.67 | 10.00±11.33 |
| 20 | 8.33±8.33 | 8.67±9.33 | 7.67±6.67 | 8.33±9.33 |
| 15 | 7.67±7.33 | 8.00±7.00 | 5.00±7.00 | 5.00±7.00 |
| 10 | 5.00±6.00 | 4.33±6.00 | 4.00±5.00 | 4.00±5.00 |
| 5 | 3.33±4.00 | 3.67±4.33 | 3.33±3.67 | 3.33±4.33 |
Table 1. The mean of Azadirachta indica and Ocimum gratissimum of Organism used Pseudomonas aeruginosa.
Isolation of the plants Rhizosphere microorganisms
The soil sample was serially diluted in distilled water under the aseptic conditions under laminar air flow chamber. Serial dilutions were made up into the ratio of 10-3 and 10-5 with 0.1 ml of each dilution poured on different sterile Petri dish containing antibacterial agent (50 μg/ml Streptomycin) [17].
Nutrient Agar (NA) was sterilized in the autoclave at 121?C for 15 minutes. It could cool for 5 minutes and then poured on the Petri dishes which was initially filled with 0.1ml of d diluted samples. Morphologically, different bacteria colonies were separated by inoculating each colony on the different selective media such as Eosin Methylene Blue Agar (EMB), MacConkey Agar, Centrimid, and Salmonella Shigella Agar to maintain the pure culture (Table 2).
| Conc. (µM) | Ethanol | N-Hexane | Ethanol + aqueous | Aqueous |
|---|---|---|---|---|
| 25 | 10.00±10.33 | 11.67±11.67 | 8.33±10.33 | 11.67±11.00 |
| 20 | 9.33±10.00 | 8.33±10.00 | 6.67±9.33 | 8.00±9.67 |
| 15 | 8.00±9.00 | 7.00±9.00 | 6.33±9.00 | 7.00±8.00 |
| 10 | 7.33±8.33 | 5.00±6.67 | 5.67±7.67 | 5.00±6.33 |
| 5 | 5.67±6.67 | 3.67±5.00 | 4.33±5.67 | 4.33±4.67 |
Table 2. The mean of Azadirachta indica and Ocimum gratissimum of Organism used Pseudomonas monteilii.
Molecular Characterization
DNA extraction
Fungal/Bacterial DNA Miniprep. (Manufactured by Zymo research cat number: D6005)2 millilitres of bacterial cells broth were added to a ZR Bashing TM Lysis Tube. Then 750 μl Lysis Solution to the tube. And then it was secured in a bead fitted with 2 ml tube holder assembly and was processed at maximum speed for maximum of 5 minutes. The ZR Bashing Bead TM Lysis Tube was centrifuged in a micro-centrifuge at >10,000 xg for 1 minute and then transferred up to 400 μl supernatant to a Zymo-SpinTM IV Spin Filter (orange top) in a Collection Tube and also centrifuged at 7,000 xg for 1 minute. Add 1,200 μl of Fungal/Bacterial DNA Binding Buffer to the filtrate in the Collection Tube and Transfer 800 μl of the mixture to a Zymo-SpinTM IIC Column in a Collection Tube before centrifuged at 10,000 xg for 1 minute. The flow through from the Collection Tube was discarded and repeated again as from above, Add 200 μl DNA Pre-Wash Buffer to the Zymo- Spin TM IIC Column in new Collection Tube and centrifuged at 10,000 xg for 1 minute then add another 500 μl Fungal/ Bacterial DNA Wash Buffer to the Zymo-SpinTM IIC Column and centrifuged at 10,000 xg for 1 minute then transferred the Zymo-SpinTM IIC Column to a clean 1.5 ml microcentrifuge tube and add 100 μl (35 μl minimum) DNA Elution Buffer directly to the column matrix. Centrifuge at 10,000 xg for 30 seconds to elute the DNA (Table 3).
| Antibiotics (µg) | 10-3 | 10-5 | 10-7 | 10-7 |
|---|---|---|---|---|
| Ceffazidine (CAZ) | R | R | R | R |
| Cefuroxine (CRX) | R | R | R | R |
| Gentamicin (GEN) | 13(I) | 14(I) | 12(S) | 17(S) |
| Ceftriazone (CTR) | R | R | R | 21(S) |
| Erythromycin (ERY) | R | R | R | R |
| Cloxacilin (CAC) | R | R | R | R |
| Ofloxacin (OFL) | 23(S) | 20(S) | 23(S) | 29(S) |
| Augmentin (AUG) | R | R | R | R |
Resistance (R) Ranges from (0-11), Susceptible (S) <15, = Intermediate (12-14).
Table 3: Antibiotics Sensitivity profile of Pseudomonas aeruginosa.
Gel Electrophoresis for DNA and PCR analysis for band visualization
Measure 1 g and 2 g of agarose (for DNA) and PCR respectively. Agarose powder was mixed with 100 mL 1 × TAE in a microwavable flask and microwaved for 3 minutes until the agarose was completely dissolved (but do not over boil the solution, as some of the buffer will evaporate) and thus alter the final percentage of agarose in the gel then wait till the agarose solution cool down to about 50?C (about when you can comfortably keep your hand on the flask) for about 5 minutes.
Then add 10 μL Ethidium Bromide was added to visualize the DNA stained. EtBR2 binds to the DNA and allowed to visualize the DNA under ultraviolet (UV) light. The agarose was poured into a gel tray with the well comb in place and was placed into newly poured gel at 4?C for 10-15 minutes (Table 4).
| Antibiotics (µg) | 10-3 | 10-5 | 10-7 | 10-9 |
|---|---|---|---|---|
| Ceffazidine (CAZ) | R | R | R | R |
| Cefuroxine(CRX) | R | R | R | R |
| Gentamicin (GEN) | 13(S) | 15(S) | 10(I) | 12(S) |
| Ceftriazone (CTR) | R | R | R | 21(S) |
| Erythromycin (ERY) | R | R | R | R |
| Cloxacilin (CAC) | R | R | R | R |
| Ofloxacin (OFL) | 25(S) | 14(S) | 22(S) | 23(S) |
| Augmentin (AUG) | R | R | R | R |
Resistance (R) Ranges from (0-11), Susceptible (S) <15 = Intermediateranges from (12-14).
Table 4. Antibiotics Sensitivity profile of Pseudomonas monteilii.
Loading samples and running an agarose gel
Add loading buffer to each of the DNA samples or PCR products once it is solidified, place the agarose gel into the gel box (electrophoresis unit). Then gel box was filled with 1 x TAE (or TBE) until the gel was completely covered. Carefully, load a molecular weight ladder into the first lane of the gel before loading the samples into the additional wells of the gel to run the gel at 80-150 V for about 1-1.5 hours then turn OFF the power button. The electrodes from the power source was disconnected immediately, and then carefully removed the gel from the gel box to visualize DNA fragments or PCR product under UV trans-illuminator.
PCR mix components
The PCR mix was made up of 12.5 μL of Taq. 2X Master Mix from New England Bio labs (M0270) containing 1 μL each of 10 μM forward and reverse primer; 2 μL of DNA template and then made up with 8.5 μL Nuclease free water. The Primer Sequences used for Bacterial identification 27F: AGAGTTTGATCMTGGCTCAG1525R: AAGGAGGTGWTCCARCCGCA. The initial denaturation at 94?C for 5 minutes was followed by 36 cycles of denaturation at 94?C for 30 seconds, at annealing temperature of 55?C for 30 seconds while elongation was at 72?C for 45 sec. Followed by a final elongation step at 72 ? C for 7 minutes and hold temperature at 10?C forever.
16S rRNA sequencing techniques
DNA sequencing method was performed by using Sanger sequencing techniques for confirmative detection of pathogenic strains of Pseudomonas spp. based on 16SrRNA gene. The purified 16srRNA gene in PCR product samples was sent to Gen Lab for onward transmission according to the protocol described by [18].
BLAST
The resulting genomic sequences were assembled and submitted in GenBank-NCBI then multiple sequence pairwise alignment search tool for phylogenetic tree construction and phylogenetic analysis by using MEGA 5.2 software.
Statistical analysis
Statistical analysis was performed using the software Statistical Package for Social Sciences (SPSS) The disc diffusion values of different concentrations of Azadirachta indica and Ocimum gratissimum leaves extract, positive against all the bacteria were entered in the SPSS software for statistical analysis. Descriptive statistics was retrieved, and data were analysed using one-way analysis of variance (ANOVA), while Tukey post-hoc test was used for comparison within the group and with different groups at the statistical significance level set at P<0.05.
Sample code: NSP
Identified organism:Pseudomonas aeruginosa strain P1
% Pairwise identity: 82.30%
NCBI accession number: KF530797
E value: 3.29E-07
Isolate sequences
GGCGGTATACTATGATGACATGGCTCGGTGCGGTTGGATCCCTCC TAATATTTTGACCAGAGGCCAGTGGATGCCTATGACTCTACCAGGGC CTGGGGGACGGCGTTTCCTAAGGGAGCTGATACCGCTTACGTCCTA CGGCACAAAACAGGGGACCTTCACCTTTTGCCCTCTCGCATGAGCA TGGGTCCATTTAGCTTTTTGTTGGGGTGGGGCTCACCATCGCCTCG ATCACTATCTGTTCTTAGTCTATGATCATTCCCACTGACACTGAAACT GGGACAAGACCCCTACTCCTGGCGGAGGTGGCGAATATTGATATTT CGCCAAAAGCCTGATCCTGACGCGCCCCTGGCGTGAATGTGGTCAT CGCCTTCAAATTCACTTTAACTTGCGGCGAAGAGCAGGGAGTTAAT ACCTTGCTGTTTTGACTTTAACGACACTATAAGAACAAGCTAACTCT GTCTCCGCGCCCGCGGCCATACTAATGGGGGCAAGTGTTAATCTTA ATTACAGTTCCGTAAACGCTCCCCCCCCGTGCTTTTGTTTTTTTTAAA TGTAGATACCCACGTGCCTCCGGGCTTGAACACGTGTTTCCGTATTT TGTCACTGCTAGAGCTCCAGTACTCGGCAGAGGGGATTTTTTCCTTT TCCCGCGGTATCACTGCAATATATATCACAGATGGAACCACCAATCCC CCGAGGGCCACCCCCCTCCCCCCTGATACCATACACTGACGTCCCAG ACGCCGGTGGGGGGCGCCACAAGATTTATTTAGCATTTCCCTGGCC CTCCCTCCGCTCCCACGAGCGGATACCCCCTCTCTCCACACTTGTGG AAATTCTCCTTTGCGACAATTTTTTGACTCGTGGCTTCACGAGAACG C
Sample code: S5P
Identified organism: Pseudomonas monteilii strain DPA clone b
% Pairwise identity: 93.30%
NCBI accession number: KJ676707
E value: 0
Isolate sequences
GGTAGATATGTGGACATGGCTCAGGTGCGGTGGGACACCCCTTT ATAGTTTGACGGCCTCAGGGGGGCGGGAAAACCCCTTAAAATATTG GGCGACCCCCTTTCGAAAGGAACGCTAATACCTAATACGTCCTACG GGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCT AGGTCGGATTAACTAGTTGGTGGGGTAATGGCTCACCAAGGCGAC GATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAG ACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGA CAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAG GTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAA GTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCT AACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTA ATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTT GGATGTGAAAGCCCCCGGGCTCATCCTGCGAACTGCATCCAAAAAC TGGCAAGCTAGCAGTACGGCTAGAGGGGTGGTGGAATTTCCCTGT GTAGCGGTGAATGCGTAGATATAGGAAGGAACACCAGTGGCGAGG CGACCACCCTGCACTGAATACTGACTACTGAGGTGGCGAAGCGTGG GGGAGCAAACAAGCATGAGATACCCTTGGTAGTTCCCACCGCCCGT CAGAACGGATGGACAACTTAGGCCGTAGGAAGTCCCTCGGAAGAT GTTCAGTGGCAACGCTCAAGGTTGAAATCGCGCC
Results and Discussion
This study examined the antimicrobial activity based on the active components of fresh leaves of Ocimum gratissimum and Azadirachta indica [3-6] on Pseudomonas [7,8]. The zone of inhibition observed in this study is comparable to those obtained in other studies. This study showed that N hexane, ethanol and aqueous leaf extracts of Ocimum gratissimum and Azadirachaindica were resistant to the bacterial isolates.
In this study, the leaf extract did not show any inhibitory activity against any of the gram-negative bacteria. This could probably be due to the biochemical differences in the structure within the cell components of bacteria. The solvents used in this study was consistent with earlier studies [17-20]. The ethanol, aqueous, N-hexane extract of Azadirachta indica leaves were with different concentration (25, 50, 75, 100 g/ml) respectively against the bacteria of E.coli and Salmonella spp respectively in the present observation. This extract of Azadirachta indica showed no zone of inhibitory on extract but the control of each only inhibited, the statistical analysis of the extracts was not significant to inhibit the bacteria isolates. The ethanolic extract of the leaves of Ocimium gratissimum, used in traditional medicine for the treatment of several ailments such as urinary tract, wound, skin and gastrointestinal infections, was evaluated for its antibacterial properties against four clinical bacteria isolates namely: Escherichia coli, Proteus mirabilis, Staphylococcus aureus and Pseudomonas aeruginosa and the antifungal properties [21]. A. indica leaves have been reported to possessed good anti-bacterial activity and this lead [13] to conclude it confirmation as a great potential of bioactive compounds of primary health care [21]. Plant essential extracts have been used for many resins, thousands of years, in food preservation pharmaceuticals, alternative medicine and natural therapies. Plant extracts are potential sources of novel antimicrobial compounds especially against bacterial pathogens. The studies in this work showed that the plant extracts inhibited bacterial growth but their effectiveness (control) varied [22].
The findings of this study donot agree with that of several researchers that demonstrated Azadirachta indica and O. gratissimum extracts have an antibacterial activity against several species of bacteria. Therefore, the efficacy of these extracts as reported the plant extract contradict the study of this [22-26]. May be due to the age of the plant, solvent extraction, extraction method and the period of harvest of plant materials. The traditional identification of bacteria based on phenotypic characteristics is generally not as accurate as identification based on genotypic methods (Tables 5 and 6).
| Strains | % similarity based on partial sequence of 16S rRNA | |
|---|---|---|
| Pseudomonas aeruginosa | KF530797.1 | 100 |
| Bacterium Strain GXII | KF96438.1 | 94.43 |
| Bacterium strain AS16 | MN096674.1 | 94.28 |
| P. mosselii strain BFPB7816S | EF600876.1 | 94.28 |
| Bacterium strain F7-2 | KT759002.1 | 94.27 |
| Endophytic bacterium 126P-3 | JF901369.1 | 94.08 |
Table 5. 16S rRNA sequence variability values based on partial sequence comparison of Pseudomonas aeruginosa.
| Strains | % similarity based on partial sequence of 16S rRNA | |
|---|---|---|
| Pseudomonas monteilii | KJ676707.1 | 100 |
| P. putida | LR134299.1 | 99.93 |
| P. spp ASDP1 | KU375114.1 | 99.93 |
| Bacillus spp SKM33 | LM6553116.1 | 99.93 |
| P. monteiliistrain 170620603RE | CP043396.1 | 99.86 |
| Bacterium B22-1 | KC709506.1 | 99.79 |
Table 6. 16S rRNA sequence variability values based on partial sequence comparison of Pseudomonas monteilii.
Conclusion
The sensitivity of gram negative bacteria on the two organism used for this study are coded with N5P and S5P which is known as Pseudomonas monteilii and Pseudomonas aeruginosa after being taken for their sequencings which were showed that Gentamycin (GEN) and Ofloxacin (OFL) were susceptible to the bacteria. The observed sequence variability between the two species of Pseudomonas was still another testimonial of the fact that Pseudomonas monteilii and aeruginosa are still far apart comparing of 99.93% to 94.28%. The result confirmed the earlier studies.
Conflict of Interests
The authors declared that there is no conflict of interest whatsoever
29746