- (2016) Volume 8, Issue 1
Sarah Canterberry, Daniel Bennett and Robert J. Wiggers*
Department of Biology, Stephen F. Austin State University, Nacogdoches, TX, USA
Received date: November 17, 2015; Accepted date: December 16, 2015; Published date: December 23, 2015
Citation: Wiggers RJ. The Frequency of Ticks Carrying Rickettsia sp. Bacteria in Eastern Texas. Arch Med. 2015, 8:1.
Background: Bacteria within the genus Rickettsia are obligate intracellular parasites, spread by arthropod vectors, that cause a number of human illnesses. In the United States, Spotted Fever Rickettsioses have been increasing for the past 4 years, and an increasing number of pathogenic or suspected pathogenic species of Rickettsia are being found in ticks. Multiple studies have indicated that up to 70% of ticks may carry one or more species of Rickettsia and have the potential to spread them to humans. The purpose of this study was to determine the extent to which ticks carried Rickettsia sp. bacteria in the eastern Texas area.
Methods and Findings: 35 ticks, 29 Ixodes sp. and 6 Amblyomma maculatum, were collected and subjected to total DNA isolation. PCR amplifications were performed using primers for the 17 kDa antigen for Rickettsia sp. in all ticks. 20 of the Ixodes ticks and 1 A. maculatum were positive for Rickettsia. The positive A. maculatum DNA was then subjected to PCR amplification using primers specific for R. parkeri, the causal organism of Tidewater fever for which A. maculatum is the only known vector. Overall, 21 of the 35 ticks (60%) were demonstrated to be carrying Rickettsia sp. bacteria; PCR confirmed that the single positive A. maculatum tick was carrying R. parkeri.
Conclusions: In the eastern Texas area, a significant proportion of ticks carry potential rickettsia pathogens. Physicians should consider the possibility of a rickettsial infection when a patient presents with a febrile illness and reports exposure to ticks.
Keywords
Rickettsia, Zoonosis, Ticks
Introduction
Pathogenic members of the genus Rickettsia are generally divided into (3) broad groups: The Spotted Fever Group (SFG), The Typhus Group (TG), and the Scrub Group (SG). Distributed world–wide, they cause a variety of fillnesses of varying severity; maintained with a mammalian host, they are spread to humans via an arthropod vector (Table 1; from [1]).
| Group | Species | Disease | Vector |
| Typhus | R. prowazekii | Epidemic typhus | Lice |
| R. typhi | Murine typhus | Fleas | |
| R. felis | Murine typhus-like | Fleas | |
| Spotted Fever | R. rickettsii | Rocky Mountain Spotted Fever | Ticks |
| R. parkeri | Tidewater Fever | Ticks | |
| R. australis | Queensland tick fever | Ticks | |
| Scrub | Orientiatsutsugamushi Previously R. tsutsugamushi |
Scrub typhus | Mites |
Table 1: The Rickettsial groups, respresentative species, and associated illnesses.
In the United States, suspected or confirmed cases of Rocky Mountain Spotted Fever (SFG group) have been reported to the Centers for Disease Control (CDC) since 1944 [2]. In 2010 the CDC changed the reportable condition to Spotted Fever Rickettsiosis (SFR), including but not limited to Rocky Mountain Spotted Fever; both confirmed and suspected cases of SFR must be reported. In 2010, the first year of the new reporting rules, 1835 suspected cases and 156 confirmed cases of SFR were reported [3]. By 2013 those numbers had climbed to 3181 suspected and 174 confirmed cases of SFR [4].
While the reasons for the increase in cases remains unclear, more studies are suggesting that additional Rickettsia sp. may be human pathogens capable of producing SFR symptoms. In 2004 [5] reported that R. parkeri was the causal organism of Tidewater Fever, while a 2014 a study found antibodies to R. rickettsia, R. parkeri, and R. amblyommii in the sera of confirmed or suspected SFR cases [6]. In Brazos County, Texas, USA, an arthropod tick was found to be infected with R. monacensis, responsible for a Mediterranean Spotted Fever like illness found across Europe and Northern Africa [7]. In Oklahoma, Kansas, and Virginia, a Spotted Fever Group rickettsia, Candidatus R. andeanae, first identified in Peru [8] and of unknown pathogenicity, has been identified [9,10] in ticks. In Oklahoma and Kansas, it appears that Candidatus R. andeanae may displace R. parkeri from its only known vector Amblyomma maculatum, the Gulf Coast tick [10]. In addition to the findings regarding the distribution of these SFG rickettsia, previous studies in eastern Texas have indicated that as much as 16% of the local population is seropositive for R. typhi or R. felis, two members of the TG that can cause febrile illness [11,12] and that R. typhi infections may be on the increase in Galveston, Texas, USA [13].
It is becoming clear that there is a diversity of pathogenic Rickettsia sp. circulating amongst arthropod vectors in the Unites States, potentially exposing large numbers of individuals to infection. The purpose of this study was to determine the extent to which ticks in the east Texas area carry Rickettsia sp bacteria.
Materials and Methods
Ticks: A total of 35 live tick adults were collected in Nacogdoches County in eastern Texas and stored in ethanol for transport back to the laboratory. Of these 35 ticks, 29 were identified as members of the genus Ixodes while the remaining 6 were identified as A. maculatum, the Gulf Coast tick.
DNA isolation: DNA was extracted from all tick specimens utilizing the DNeasy Blood and Tissue Isolation Kit (QIAGEN, Valencia, CA, USA) following manufacturer’s instructions, including modifications for the isolation of DNA from tick specimens. Once isolated, DNA was stored at -20°C.
PCR amplification: DNA from all ticks was subjected to PCR amplification utilizing primers R17K128F2 and R17K128R for the Rickettsia sp. 17 kDa antigen gene. DNA from the A. maculatum ticks was additionally subjected to PCR amplification utilizing primers Rpa129F and Rpa224R for the ompB gene of R. parkeri. Primer sequences are from previously published work [14] and are shown in Table 2. PCR amplifications were performed using a Bio-Rad C-1000 Thermal Cycler and a Platinum PCR kit from Invitrogen/ThermoFisher (Waltham, MA, USA). PCR products were electrophoresed using a 1.7% agarose gel and a 100 bp DNA ladder for fragment identification via size determination.
| Primer Name | Sequence | Amplified Fragment Length |
| Rpa129F | 5’CAAATGTTGCAGTTCCTCTAAATG | 96 bp |
| Rpa224R | 5’AAAACAAACCGTTAAAACTACCG | |
| R17K128F2 | 5’GGGCGGTATGAAYAAACAAG | 111 bp |
| R17K128R | 5’CCTACACCTACTCCVACAAG |
Table 2: Primer sequences for amplification of Rickettsia DNA from the collected ticks [14].
Results and Discussion
Of the 29 Ixodes sp. ticks collected, 20 of them were Rickettsia positive as indicated by the successful amplification of the 111 bp DNA fragment from the 17 kDa antigen gene. One of the six A. maculatum ticks was also positive for R. parkeri, as indicated by the successful amplification of the 96 bp DNA fragment from the species specific sequence of the ompB gene. Collectively, 21 of the 35 ticks (60%) were determined to be carrying a Rickettsia sp. bacterium. This rickettsia positive frequency is well within the range of that which has been reported in other studies (Table 3). It should be noted that several of the identified Rickettsia sp., notably R. montanensis, R. amblyommi, and Candidatus R. andeanae, are of unknown pathogenicity [15-17].
The generally high frequency of rickettsia positive ticks in the United States suggests that when individuals encounter ticks, they are likely to be carrying a potential pathogen yet the potential public health implications of this remain unclear. While specific Spotted Fever rickettsioses have been linked to R. parkeri (Tidewater Fever) and R. rickettsia (Rocky Mountain Spotted Fever), several other studies have tentatively linked rickettsioses to other species identified in the studies cited in table 3: R. amblyommii has been linked to infections in North Carolina [18] and R. montanensis to an afebrile rash illness in a patient bitten by a tick confirmed to carry the organism [19].
| Location | Rickettsia (+) Ticks | Identified Rickettsia sp. | Reference |
| Tennessee | 57% | R. amblyommii& other Unidentified Rickettsia sp. | [15] |
| Kansas | 47% | R. andeanae | [10] |
| Oklahoma | 73% | R. andeanae | [10] |
| Virginia | 43% | R. parkeri | [14] |
| Florida | 57% | R. amblyommii | [16] |
| Arkansas | 30% | R. amblyommii, R. montanensis | [17] |
Table 3: The percentage of Rickettsia positive ticks from various locations in the United States.
In the United States, most cases of SFG rickettsioses are caused by R. rickettsii (Rocky Mountain Spotted Fever -RMSF), R. akari (rickettsialpox), or R. parkeri (Tidewater Fever) [20]. Of these three diseases, only RMSF is considered potentially fatal, with a case fatality rate of less than 4% in the antibiotic era [21]. This being said, it is possible that less pathogenic Rickettsia sp. are a significant source of human illness. A study of soldiers at Fort Chaffee, Arkansas (USA) found that those soldiers seropositive for R. amblyommii had experienced headaches, myalgia, arthralgia, fever, and chills at a significantly higher rate than those who were not seropositive [21]. A rickettsiosis, particularly RMSF, should be considered if a patient presents with a fever (particularly in the spring or summer), reported tick exposure, or travel to an endemic area [22]. A classic triad of symptoms associated with a rickettsiosis (fever, headache, and rash) may be present is as little as 5% of patients at initial presentation [22] which can cause delays beginning antibiotic therapy. The median delay between presentation at a primary clinical provider and beginning treatment has been reported as five days. This delay can be particularly dangerous in the case of RMSF, as most fatalities can be traced to treatment delays [22].
In 2013, 83 cases of confirmed or suspected Spotted Fever Rickettsiosis were reported in Texas, most of them in the summer months [4]. Given the high frequency of rickettsia positive ticks, a rickettsiosis should be presumed, and antibiotic therapy begun, in any patient with an otherwise unexplained febrile illness, particularly if that patient reports a recent tick bite or spends a significant portion of their time outdoors, even if not in a rural environment where ticks are likely to be encountered-a recent study found that even in an urban area, ticks found in parks and other greenbelts were often carrying rickettsia [23]. The authors have identified two specific clinical cases in which such a presumption and prompt treatment would have prevented significant morbidity and costs. Both patients were male, in their thirties, presented with fever and myalgia during the summer months, and, while neither reported tick exposure, both indicated extensive outdoor activity. Neither patient had a rash at the initial visit with a health care provider. Patient (1) was diagnosed with influenza and treated unsuccessfully with amantadine for five days before requiring hospitalization and treatment with doxycycline. Post convalescent immuno assays indicated that the illness was caused by an unidentified species of SFG Rickettsia. Patient (2) received no antibiotic therapy for seven days until hospitalization with a diagnosis of an SFG infection. The patient recovered after treatment with doxycycline. In both cases, hospitalization could likely have been avoided with a presumptive diagnosis of rickettsiosis and appropriate antibiotic treatment.
Acknowledgment
“Conducted under a grant from the Stephen F. Austin State University Research Enhancement Program.”
7937
